Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCACAAAGCCAGCCTGAGTCCCTG[C/G]TGGATACAGCTCACCAGGGGGGATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607033 MIM: 604709 | ||||||||||||||||||||
Literature Links: |
CLDN20 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLDN20 - claudin 20 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001346.3 | Intron | NP_001001346.1 | ||||
XM_011535848.2 | Intron | XP_011534150.1 |
TFB1M - transcription factor B1, mitochondrial | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016020.3 | Intron | NP_057104.2 | ||||
XM_005267006.4 | Intron | XP_005267063.1 | ||||
XM_011535870.1 | Intron | XP_011534172.1 | ||||
XM_011535871.1 | Intron | XP_011534173.1 | ||||
XM_011535872.2 | Intron | XP_011534174.1 | ||||
XM_011535873.2 | Intron | XP_011534175.1 | ||||
XM_017010917.1 | Intron | XP_016866406.1 |
TIAM2 - T-cell lymphoma invasion and metastasis 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |