Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTAGGGCCTCTGGTTTCACCAAACC[A/G]TCTCCAACTGGAATACACAAAAGTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
17 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605960 MIM: 601231 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
EXOSC10 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
EXOSC10 - exosome component 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105376736 - uncharacterized LOC105376736 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MTOR - mechanistic target of rapamycin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004958.3 | 7039 | Silent Mutation | GAC,GAT | D,D 2485 | NP_004949.1 | |
XM_005263438.2 | 7039 | Silent Mutation | GAC,GAT | D,D 2485 | XP_005263495.1 | |
XM_011541166.2 | 7039 | Intron | XP_011539468.1 | |||
XM_017000900.1 | 7039 | Silent Mutation | GAC,GAT | D,D 2258 | XP_016856389.1 | |
XM_017000901.1 | 7039 | Silent Mutation | GAC,GAT | D,D 2069 | XP_016856390.1 | |
XM_017000902.1 | 7039 | Intron | XP_016856391.1 |