Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGCTGCCTACCTGGGCATAGCTTC[A/G]AAAGAAGATCTGCTGGGGGCTGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613883 MIM: 606679 | ||||||||||||||||||||
Literature Links: |
C7orf34 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C7orf34 - chromosome 7 open reading frame 34 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KEL - Kell blood group, metallo-endopeptidase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000420.2 | 1404 | Nonsense Mutation | CGA,TGA | R,* 675 | NP_000411.1 | |
XM_005249993.2 | 1404 | Nonsense Mutation | CGA,TGA | R,* 687 | XP_005250050.1 | |
XM_005249994.3 | 1404 | Nonsense Mutation | CGA,TGA | R,* 366 | XP_005250051.1 |
TRPV5 - transient receptor potential cation channel subfamily V member 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |