Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGACCCGGATAAGCTGGAAGCAG[A/C]CGTTGCGGTTGGCGAAGACGTGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600944 MIM: 609074 MIM: 603002 | ||||||||||||||||||||
Literature Links: |
DHPS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DHPS - deoxyhypusine synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBXW9 - F-box and WD repeat domain containing 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032301.2 | 1306 | Missense Mutation | NP_115677.2 | |||
XM_005260096.4 | 1306 | Missense Mutation | XP_005260153.1 |
LOC105372280 - uncharacterized LOC105372280 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNPO2 - transportin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |