Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTACCAGATTCTCAGCTCTTCTAG[A/G]ATGAGATTTCTCAAAGTTTAATTTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603648 MIM: 610415 MIM: 604701 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
COX11 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
COX11 - COX11, cytochrome c oxidase copper chaperone | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001162861.2 | 392 | Intron | NP_001156333.1 | |||
NM_001162862.2 | 392 | Intron | NP_001156334.1 | |||
NM_001321518.1 | 392 | Intron | NP_001308447.1 | |||
NM_004375.4 | 392 | Intron | NP_004366.1 | |||
XM_011524342.2 | 392 | UTR 5 | XP_011522644.1 | |||
XM_017024192.1 | 392 | UTR 5 | XP_016879681.1 | |||
XM_017024193.1 | 392 | Intron | XP_016879682.1 | |||
XM_017024194.1 | 392 | Intron | XP_016879683.1 | |||
XM_017024195.1 | 392 | Intron | XP_016879684.1 | |||
XM_017024196.1 | 392 | Intron | XP_016879685.1 |
STXBP4 - syntaxin binding protein 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178509.5 | 392 | Intron | NP_848604.3 | |||
XM_005257187.4 | 392 | Intron | XP_005257244.1 | |||
XM_006721797.3 | 392 | Intron | XP_006721860.1 | |||
XM_006721798.3 | 392 | Intron | XP_006721861.1 | |||
XM_017024410.1 | 392 | Intron | XP_016879899.1 | |||
XM_017024411.1 | 392 | Intron | XP_016879900.1 | |||
XM_017024412.1 | 392 | Intron | XP_016879901.1 | |||
XM_017024413.1 | 392 | Intron | XP_016879902.1 | |||
XM_017024414.1 | 392 | Intron | XP_016879903.1 | |||
XM_017024415.1 | 392 | Intron | XP_016879904.1 |
TOM1L1 - target of myb1 like 1 membrane trafficking protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |