Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACACCGGCTTCAGCCAGAGCTCGCA[C/T]CCGCCTGCGCCGCTCCACCCACCCA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 610516 MIM: 611059 | |||||||||||||||||||||||
Literature Links: |
GLYCTK PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
GLYCTK - glycerate kinase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001144951.1 | 215 | Intron | NP_001138423.1 | |||
NM_145262.3 | 215 | Intron | NP_660305.2 | |||
XM_017005730.1 | 215 | UTR 5 | XP_016861219.1 |
GLYCTK-AS1 - GLYCTK antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR135A1 - microRNA 135a-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR82 - WD repeat domain 82 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |