Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCCTTTACCCCTTCTTTCCCTGG[A/C]TGAGCCCCACCCCCACCTTACCACC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 151440 MIM: 164005 MIM: 611669 | |||||||||||||||||||||||
Literature Links: |
LYL1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
LYL1 - LYL1, basic helix-loop-helix family member | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NFIX - nuclear factor I X | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRMT1 - tRNA methyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136035.2 | Intron | NP_001129507.1 | ||||
NM_001142554.1 | Intron | NP_001136026.1 | ||||
NM_017722.3 | Intron | NP_060192.1 | ||||
XM_006722793.2 | Intron | XP_006722856.1 | ||||
XM_011528124.1 | Intron | XP_011526426.1 | ||||
XM_011528125.1 | Intron | XP_011526427.1 | ||||
XM_017026944.1 | Intron | XP_016882433.1 | ||||
XM_017026945.1 | Intron | XP_016882434.1 | ||||
XM_017026946.1 | Intron | XP_016882435.1 | ||||
XM_017026947.1 | Intron | XP_016882436.1 |
Set Membership: |
HapMap |