Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGACGATGGTGGGGTGGCAAGGCA[A/G]GAGCTGATGGAGACTCACTGAGAAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609077 MIM: 602438 MIM: 605235 | ||||||||||||||||||||
Literature Links: |
FBXL8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXL8 - F-box and leucine rich repeat protein 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HSF4 - heat shock transcription factor 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KIAA0895L - KIAA0895 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOL3 - nucleolar protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001185057.2 | Intron | NP_001171986.1 | ||||
NM_001276307.1 | Intron | NP_001263236.1 | ||||
NM_001276309.1 | Intron | NP_001263238.1 | ||||
NM_001276311.1 | Intron | NP_001263240.1 | ||||
NM_001276312.1 | Intron | NP_001263241.1 | ||||
NM_001276319.1 | Intron | NP_001263248.1 | ||||
NM_003946.6 | Intron | NP_003937.1 | ||||
XM_005256217.2 | Intron | XP_005256274.1 | ||||
XM_005256219.3 | Intron | XP_005256276.1 | ||||
XM_011523424.2 | Intron | XP_011521726.1 | ||||
XM_017023843.1 | Intron | XP_016879332.1 |