Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGCAGAAAAATCCTGCCCTCCCCC[A/G]AAGGGAGAAGAGGTTCAAAAATGTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606853 MIM: 142560 MIM: 609624 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP6V1G2 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
ATP6V1G2 - ATPase H+ transporting V1 subunit G2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ATP6V1G2-DDX39B - ATP6V1G2-DDX39B readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DDX39B - DEAD-box helicase 39B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004640.6 | Intron | NP_004631.1 | ||||
NM_080598.5 | Intron | NP_542165.1 |
DDX39B-AS1 - DDX39B antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MCCD1 - mitochondrial coiled-coil domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD117 - small nucleolar RNA, C/D box 117 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD84 - small nucleolar RNA, C/D box 84 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |