Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCACCTTCCACGACCAGGAGAGGCA[C/G]TGGGGAGGGGTCACAGGGATGCCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 118820 MIM: 139240 | ||||||||||||||||||||
Literature Links: |
CSH2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CSH2 - chorionic somatomammotropin hormone 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GH2 - growth hormone 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002059.4 | 825 | UTR 3 | NP_002050.1 | |||
NM_022556.3 | 825 | UTR 3 | NP_072050.1 | |||
NM_022557.3 | 825 | UTR 3 | NP_072051.1 | |||
NM_022558.3 | 825 | Missense Mutation | CAC,CAG | H,Q 228 | NP_072052.1 |
LOC107987248 - intercellular adhesion molecule 1-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |