Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGTGATATTGGATTGGTGGCATC[G/T]TTAGACACTCTCCCGGGATGTGTGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611019 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACTR3C PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ACTR3C - ARP3 actin-related protein 3 homolog C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001164458.1 | 6494 | Intron | NP_001157930.1 | |||
NM_001164459.1 | 6494 | Intron | NP_001157931.1 | |||
XM_005250043.4 | 6494 | Intron | XP_005250100.3 | |||
XM_011516502.2 | 6494 | Intron | XP_011514804.1 | |||
XM_011516506.2 | 6494 | Intron | XP_011514808.1 | |||
XM_011516507.2 | 6494 | Intron | XP_011514809.1 | |||
XM_011516508.2 | 6494 | Intron | XP_011514810.1 | |||
XM_011516511.2 | 6494 | Intron | XP_011514813.1 | |||
XM_017012548.1 | 6494 | UTR 3 | XP_016868037.1 | |||
XM_017012549.1 | 6494 | Intron | XP_016868038.1 | |||
XM_017012550.1 | 6494 | UTR 3 | XP_016868039.1 | |||
XM_017012551.1 | 6494 | UTR 3 | XP_016868040.1 | |||
XM_017012552.1 | 6494 | Intron | XP_016868041.1 | |||
XM_017012553.1 | 6494 | Intron | XP_016868042.1 |
ATP6V0E2 - ATPase H+ transporting V0 subunit e2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ATP6V0E2-AS1 - ATP6V0E2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |