Product Details

SNP ID: rs140387461
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:85605113 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCTGTCTAGTTGTTATGTTCCAAC[A/G]GGGACAGCTCTTAAAATAGTGTGGC
Phenotype: MIM: 612490 MIM: 616757 MIM: 611594
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C2orf68 PubMed Links

Gene Details

Gene: C2orf68
Gene Name: chromosome 2 open reading frame 68

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013649.3		Intron			NP_001013671.2
XM_005264305.3		Intron			XP_005264362.1

Gene: RNF181
Gene Name: ring finger protein 181

There are no transcripts associated with this gene.

Gene: TMEM150A
Gene Name: transmembrane protein 150A

There are no transcripts associated with this gene.

Gene: USP39
Gene Name: ubiquitin specific peptidase 39

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256725.1		Intron			NP_001243654.1
NM_001256726.1		Intron			NP_001243655.1
NM_001256727.1		Intron			NP_001243656.1
NM_001256728.1		Intron			NP_001243657.1
NM_006590.3		Intron			NP_006581.2
XM_006711922.1		Intron			XP_006711985.1
XM_006711923.2		Intron			XP_006711986.1
XM_011532487.1		Intron			XP_011530789.1
XM_011532488.1		Intron			XP_011530790.1
XM_017003182.1		Intron			XP_016858671.1

View Full Product Details