Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAAGCAGCATGTCATCGATGGAGA[A/G]AAAACCATTATCCAGAATCCCACAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 190151 MIM: 602145 MIM: 613315 | ||||||||||||||||||||
Literature Links: |
ERBB3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ERBB3 - erb-b2 receptor tyrosine kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PA2G4 - proliferation-associated 2G4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006191.2 | 1013 | Silent Mutation | GAA,GAG | E,E 198 | NP_006182.2 |
RPL41 - ribosomal protein L41 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZC3H10 - zinc finger CCCH-type containing 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |