Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGAAAGATCTAGAAGAGGTAAAG[G/T]TGTTGCTGGAAAAGGCTACTAGGAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
14 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606186 MIM: 611978 MIM: 609238 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CACYBP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CACYBP - calcyclin binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007214.1 | 415 | UTR 5 | NP_001007215.1 | |||
NM_014412.2 | 415 | Missense Mutation | GTG,TTG | V,L 15 | NP_055227.1 | |
XM_017001046.1 | 415 | UTR 5 | XP_016856535.1 |
LOC105371622 - uncharacterized LOC105371622 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS14 - mitochondrial ribosomal protein S14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RABGAP1L - RAB GTPase activating protein 1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |