Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTCGGGGTAGCCAGGGGTCCAGC[C/T]GTTACCCACCAACTGGACGGTGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 606351 MIM: 611101 MIM: 603366 | ||||||||||||||||||||
Literature Links: |
ESPN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ESPN - espin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_031475.2 | 815 | Intron | NP_113663.2 | |||
XM_005263501.2 | 815 | Intron | XP_005263558.1 | |||
XM_011542231.1 | 815 | Intron | XP_011540533.1 | |||
XM_011542232.1 | 815 | Intron | XP_011540534.1 | |||
XM_011542233.2 | 815 | Intron | XP_011540535.1 | |||
XM_011542236.2 | 815 | Intron | XP_011540538.1 | |||
XM_011542237.1 | 815 | Intron | XP_011540539.1 | |||
XM_011542238.2 | 815 | Intron | XP_011540540.1 | |||
XM_017002433.1 | 815 | Intron | XP_016857922.1 | |||
XM_017002434.1 | 815 | Intron | XP_016857923.1 |
PLEKHG5 - pleckstrin homology and RhoGEF domain containing G5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFRSF25 - TNF receptor superfamily member 25 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039664.1 | 815 | Intron | NP_001034753.1 | |||
NM_003790.2 | 815 | Missense Mutation | AGC,GGC | S,G 280 | NP_003781.1 | |
NM_148965.1 | 815 | Missense Mutation | AGC,GGC | S,G 289 | NP_683866.1 | |
NM_148966.1 | 815 | Missense Mutation | AGC,GGC | S,G 243 | NP_683867.1 | |
NM_148967.1 | 815 | Missense Mutation | AGC,GGC | S,G 235 | NP_683868.1 | |
NM_148970.1 | 815 | Missense Mutation | AGC,GGC | S,G 97 | NP_683871.1 |