Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTAATATCAATGGGCATCCATATA[A/G]GTTGGGTGACCAACCATCCCACTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601557 MIM: 191525 | ||||||||||||||||||||
Literature Links: |
ACACB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACACB - acetyl-CoA carboxylase beta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001093.3 | Intron | NP_001084.3 | ||||
XM_005253876.4 | Intron | XP_005253933.1 | ||||
XM_006719367.3 | Intron | XP_006719430.1 | ||||
XM_011538259.2 | Intron | XP_011536561.1 | ||||
XM_011538263.2 | Intron | XP_011536565.1 | ||||
XM_011538264.2 | Intron | XP_011536566.1 | ||||
XM_011538265.2 | Intron | XP_011536567.1 | ||||
XM_017019252.1 | Intron | XP_016874741.1 |
LOC105369974 - uncharacterized LOC105369974 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UNG - uracil DNA glycosylase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |