TaqMan® iPSC Sendai Detection Kit

Catalog number: A13640

Applied Biosystems™  Related applications: Real Time PCR (qPCR) | Stem Cell Analysis | Stem Cell Engineering & Reprogramming

Error loading your content!

  Catalog number
Select a plan
Unit size
List price ({{currency}}) Your price ({{currency}}) Availability Qty
{{product.sku}} {{product.sku}}
also known as {{product.formattedSku}} 
{{subscriptionDetails.selectedRatePlan.billingPeriod}} {{subscriptionDetails.selectedRatePlan.billingPeriod}} {{product.availability.message}}
Pro add-ons

Your on-site stock

›› {{supplyCenter.scName}}({{scProduct.stockOnHand}} In stock)
›› {{supplyCenter.scName}}(Out of stock)
›› {{supplyCenter.scName}}
This item is not currently available on-site. Depending on your Supply Center settings you may be able to add the item to cart above else use the Order Non-Stocked Items' tab on the Supply Center home page.
Back to top

Description

The TaqMan® iPSC Sendai Detection Kit contains 5 TaqMan® assays for detecting the presence and determining the levels of Sendai virus and exogenous transcription factors (OCT3/4, SOX2, KLF4, and cMyc) delivered to cells through use of the CytoTune™-iPS Reprogramming Kit. The assays in the TaqMan® iPSC Sendai Detection Kit will not detect the corresponding endogenous factors. The detection kit can be used both as a transduction control during reprogramming and as a high-sensitivity detection method for the presence of Sendai virus and transgenes within your iPS clones after reprogramming.

Some key benefits of this kit are:

• Identification down to 10 copies of the target sequence
• Highly specific detection of Sendai virus and exogenous transcription factor genes in human iPSC
• Easier, faster, and more sensitive confirmation of Sendai virus-free iPSC clones compared to end point PCR
• Validated assays to ensure consistent performance

The TaqMan® iPSC Sendai Detection Kit is recommended for detection of Sendai virus and exogenous transcription factors (OCT3/4, SOX2, KLF4, and cMyc) in induced pluripotent stem cells generated with Sendai virus. The included TaqMan® assays can be used at different stages during reprogramming. They can be used 48 hours post transduction of Sendai virus to detect expression levels of exogenous transcription factors delivered by Sendai virus in the transduced cells. In addition, they can be used after the generation of iPSCs at different passages to determine the presence of Sendai virus. The TaqMan® primers and probes are specific for Sendai-delivered exogenous transcription factors and will not detect the corresponding endogenous factors. The TaqMan® iPSC Sendai Detection Kit is highly sensitive, specific, and enables real time monitoring of Sendai virus expression.

The 5 TaqMan® assays included in the kit are as follows:

Assay ID Target Amplicon Length Amplicon Context Sequence
Mr04269876_mr Sendai-cMyc 89 GGGTGAATGGGAAGCGGCCGCATGC
Mr04269878_mr Sendai-OCT3/4 82 TCCCATGCATTCAAACTGACCGTAG
Mr04269879_mr Sendai-KLF4 74 CACATGAAGAGGCATTTTTAACCGT
Mr04269880_mr Sendai 59 TGCCCCAAGCAGACACCACCTGGCA
Mr04269881_mr Sendai-SOX2 62 CACATGTGACCGTAGTAAGAAAAAC


For Research Use Only. Not for diagnostic procedures.

Specifications

PCR Method: 2-Step qRT-PCR
Detection Method: Primer-Probe Detection
Primer-Probe Compatibility: TaqMan®
Reaction Speed: Fast
For Use With (Equipment): 7900HT System, 7500 System, StepOnePlus™, Fast Mode, StepOne™, Standard Mode, OpenArray®, StepOnePlus™, Standard Mode, StepOne™, Fast Mode, 7900HT Fast System, 7500 Fast System
Sample Type (General): RNA
Technique: FRET
Sensitivity: Down to 10 copies
Label or Dye: FAM™
Product Size: 75 reactions⁄assay
Target Specificity: Target-Specific
Number of Reactions: 75 Reactions
Sample Type (Specific): Total RNA, Viral RNA

Contents & storage

5 assay kits — Store at -20°C

Documents

Manuals & protocols