Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.
Highlights
• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
Applications
Synthesis of unlabeled and labeled RNA that can be used:
• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing
Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
For Research Use Only. Not for use in diagnostic procedures.