T7 RNA Polymerase (20 U/μl)
Thermo Scientific™

T7 RNA Polymerase (20 U/μl)

Thermo Scientific Bakteriophagen-T7-RNA-Polymerase ist eine DNA-abhängige RNA-Polymerase mit strikter Spezifität für ihre doppelsträngigen Promotor. Es katalysiert die 5'→3'-Synthese von RNAWeitere Informationen
Have Questions?
Ansicht ändernbuttonViewtableView
KatalognummerKonzentrationMenge
EP011120 U/µl5000 U
EP011220 U/µl5 x 5000 U
Katalognummer EP0111
Preis (EUR)
40,65
Exklusiv online
44,77
Ersparnis 4,12 (9%)
Each
Konzentration:
20 U/µl
Menge:
5000 U
Großbestellung oder individuelle Größe anfordern
Preis (EUR)
40,65
Exklusiv online
44,77
Ersparnis 4,12 (9%)
Each
Thermo Scientific Bakteriophagen-T7-RNA-Polymerase ist eine DNA-abhängige RNA-Polymerase mit strikter Spezifität für ihre doppelsträngigen Promotor. Es katalysiert die 5'→3'-Synthese von RNA entweder an einzelsträngiger oder doppelsträngiger DNA, die ihrem Promoter nachgelagert ist.

Vorteile

• Integriert modifizierte Nukleotide (z. B. Aminoallyl-, Biotin-, Fluorescein-, Digoxigenin-markierte Nukleotide)

Anwendungen

Synthese von nicht markierter und markierter RNA, verwendbar für:

• Zur Hybridisierung, In-vitro-RNA-Translation
• Als aRNA, siRNA, Substrat in RNase-Protektionsassays, Template für genomische DNA-Sequenzierung
• In Studien zur RNA-Sekundärstruktur und RNA-Proteininteraktionen, RNA-Spleißen

Konsensus-Promoter-Sequenz:
T7: TAATACGACTCACTATAGGGAGA
Nur für Forschungszwecke. Nicht zur Verwendung bei diagnostischen Verfahren.
Specifications
Konzentration20 U/µl
Menge5000 U
PolymeraseT7-RNA-Polymerase
Unit SizeEach

Häufig gestellte Fragen (FAQ)

What is the advantage of using TranscriptAid T7 High Yield Transcription Kit over Thermo Scientific T7 RNA Polymerase with a standard transcription buffer?

TranscriptAid T7 High Yield Transcription Kit is designed to produce both long and short transcripts for applications that require large yields of RNA (milligram amounts). The kit can achieve 10 times greater amount than from conventional in vitro transcription reactions with T7 RNA polymerase due to its unique proprietary enzyme and buffer formulations. Please note that TranscriptAid T7 High Yield Transcription Kit is not recommended for generation of radioactively labelled RNA. Due to large quantities of RNA synthesized with the kit, generation of high specific activity radiolabeled probes would require prohibitively large amounts of radiolabeled nucleotide.

Does the T7 RNA Polymerase (20 U/μl) (Cat. No. EP0111) contain a His-Tag which could be used for purification or conjugation?

The T7 RNA Polymerase (20 U/μl) (Cat. No. EP0111) does not contain a His-Tag, and currently none of our T7 RNA polymerases have a tag available for purification/conjugation.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.