Thermo Scientific™

T7 RNA Polymerase, HC (200 U/µL)

Catalog number: EP0113
Thermo Scientific™

T7 RNA Polymerase, HC (200 U/µL)

Catalog number: EP0113
Catalog Number
EP0113
Unit Size
25,000 units
Price (USD)
Price: 319.00
Your Price:
Availability
***
Quantity
Catalog NumberUnit SizePrice (USD)AvailabilityQuantity
EP011325,000 units
Price: 319.00
Your Price:
***
Product Overview
Figures
Videos
Documents
FAQ
Citations & References
Additional Information
Recommendations
Recommendations
Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
For Research Use Only. Not for use in diagnostic procedures.

Specifications

Concentration
>200U/µL
Polymerase
T7 RNA Polymerase
Quantity
25,000 U

Figures