pJET1.2 Reverse Sequencing Primer, 24-mer

Catalog number:  SO511

Thermo Scientific™  Related applications: DNA Sequencing

Error loading your content!

  Catalog number
Select a plan
Unit size
Price ({{currency}}) Availability Qty
{{product.sku}} {{product.sku}} also known as {{product.formattedSku}} 
Pro add-ons

Your on-site stock

›› {{supplyCenter.scName}}({{scProduct.stockOnHand}} In stock)
›› {{supplyCenter.scName}}(Out of stock)
›› {{supplyCenter.scName}}
This item is not currently available on-site. Depending on your Supply Center settings you may be able to add the item to cart above else use the Order Non-Stocked Items' tab on the Supply Center home page.
Back to top


Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.


• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

Catalog number and Primer sequence:
• SO501—pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• SO511—pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related Products
pJET1.2 Forward Sequencing Primer, 23-mer
For Research Use Only. Not for use in diagnostic procedures.


Primer Type: pJET Primers
Product Size: 10 µM


Manuals & protocols

Recommended products