Thermo Scientific™

pJET1.2 Reverse Sequencing Primer, 24-mer

Catalog number: SO511
Thermo Scientific™

pJET1.2 Reverse Sequencing Primer, 24-mer

Catalog number: SO511
Catalog Number
SO511
Unit Size
10 µM
Price (USD)
Price: 50.25
Your price:
Availability
-
Quantity
Catalog NumberUnit SizePrice (USD)AvailabilityQuantity
SO51110 µM
Price: 50.25
Your price:
-
Product Overview
Figures
Videos
Recommendations
Recommendations
Documents
FAQ
Citations & References
Additional Information
Recommendations

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Forward Sequencing Primer, 23-mer

For Research Use Only. Not for use in diagnostic procedures.

Specifications

Product Type
Forward Sequencing Primer
Shipping Condition
Dry Ice
Concentration
10 μM
Primer
pJET
Quantity
84 μL
Vector
pJET1.2
For Use With (Application)
Sequencing
Form
Liquid

Contents & Storage

pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL)

Store at –20°C.

Figures

Documents & Downloads

Certificates

    Frequently asked questions (FAQs)

    Citations & References

    Search citations by name, author, journal title or abstract text