Thermo Scientific™

pJET1.2 Reverse Sequencing Primer, 24-mer

Catalog number: SO511
Thermo Scientific™

pJET1.2 Reverse Sequencing Primer, 24-mer

Catalog number: SO511
Catalog Number
SO511
Unit Size
10 µM
Price (USD)
Price: 47.03
Your Price:
Availability
***
Quantity
Catalog NumberUnit SizePrice (USD)AvailabilityQuantity
SO51110 µM
Price: 47.03
Your Price:
***
Product Overview
Figures
Videos
Documents
FAQ
Citations & References
Additional Information
Recommendations
Recommendations
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

Catalog number and Primer sequence:
• SO501—pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• SO511—pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related Products
pJET1.2 Forward Sequencing Primer, 23-mer
For Research Use Only. Not for use in diagnostic procedures.

Specifications

Product Type
Forward Sequencing Primer
Primer
pJET
Vector
pJET1.2
For Use With (Application)
Sequencing
Form
Liquid

Figures