Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAGTCTAGTTCTGGGAGATCCTGG[A/G]CACGGAACTACTGCGTGGCCACTGC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 600686 | |||||||||||||||||||||||
Literature Links: |
KPNA1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
KPNA1 - karyopherin subunit alpha 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002264.3 | 6201 | UTR 3 | NP_002255.3 | |||
XM_005247437.3 | 6201 | Intron | XP_005247494.1 | |||
XM_005247439.3 | 6201 | Intron | XP_005247496.1 | |||
XM_011512795.2 | 6201 | Intron | XP_011511097.1 | |||
XM_011512797.2 | 6201 | Intron | XP_011511099.1 | |||
XM_017006363.1 | 6201 | Intron | XP_016861852.1 | |||
XM_017006364.1 | 6201 | Intron | XP_016861853.1 | |||
XM_017006365.1 | 6201 | Intron | XP_016861854.1 |
LOC102723582 - uncharacterized LOC102723582 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR5B - WD repeat domain 5B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |