Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGAATTGCATGCATTTGCCAAGAT[A/C]TCACACAGGGCGACGCTGAGGGAGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||
Literature Links: |
CCDC37-AS1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CCDC37-AS1 - CCDC37 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CFAP100 - cilia and flagella associated protein 100 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_182628.2 | Intron | NP_872434.2 | ||||
XM_006713623.2 | Intron | XP_006713686.1 | ||||
XM_017006320.1 | Intron | XP_016861809.1 | ||||
XM_017006321.1 | Intron | XP_016861810.1 | ||||
XM_017006322.1 | Intron | XP_016861811.1 | ||||
XM_017006323.1 | Intron | XP_016861812.1 | ||||
XM_017006324.1 | Intron | XP_016861813.1 | ||||
XM_017006325.1 | Intron | XP_016861814.1 | ||||
XM_017006326.1 | Intron | XP_016861815.1 | ||||
XM_017006327.1 | Intron | XP_016861816.1 |