Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAGAGCCCACACCGACCTTAAGG[G/T]CACTTGGGCCCTGAATCCTATGCCT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 600570 | |||||||||||||||||||||||
Literature Links: |
CLCN2 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CLCN2 - chloride voltage-gated channel 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001171087.2 | Intron | NP_001164558.1 | ||||
NM_001171088.2 | Intron | NP_001164559.1 | ||||
NM_001171089.2 | Intron | NP_001164560.1 | ||||
NM_004366.5 | Intron | NP_004357.3 | ||||
XM_006713489.1 | Intron | XP_006713552.1 | ||||
XM_006713490.2 | Intron | XP_006713553.1 | ||||
XM_011512401.1 | Intron | XP_011510703.1 |
FAM131A - family with sequence similarity 131 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |