Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGAATGAATGCTAGTGAGAAAAA[A/C]AAAAAAAGGAACAAAAACTATAAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611195 | ||||||||||||||||||||
Literature Links: |
C4orf50 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C4orf50 - chromosome 4 open reading frame 50 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
JAKMIP1 - janus kinase and microtubule interacting protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099433.1 | 2418 | Missense Mutation | TTG,TTT | L,F 821 | NP_001092903.1 | |
NM_001306133.1 | 2418 | Intron | NP_001293062.1 | |||
NM_001306134.1 | 2418 | Intron | NP_001293063.1 | |||
NM_144720.3 | 2418 | Intron | NP_653321.1 | |||
XM_011513400.2 | 2418 | Intron | XP_011511702.1 | |||
XM_017007788.1 | 2418 | Intron | XP_016863277.1 | |||
XM_017007789.1 | 2418 | Intron | XP_016863278.1 | |||
XM_017007790.1 | 2418 | Intron | XP_016863279.1 | |||
XM_017007791.1 | 2418 | Intron | XP_016863280.1 | |||
XM_017007792.1 | 2418 | Missense Mutation | TTG,TTT | L,F 825 | XP_016863281.1 | |
XM_017007793.1 | 2418 | Missense Mutation | TTG,TTT | L,F 821 | XP_016863282.1 | |
XM_017007794.1 | 2418 | Intron | XP_016863283.1 | |||
XM_017007795.1 | 2418 | Intron | XP_016863284.1 | |||
XM_017007796.1 | 2418 | Intron | XP_016863285.1 | |||
XM_017007797.1 | 2418 | Intron | XP_016863286.1 | |||
XM_017007798.1 | 2418 | Intron | XP_016863287.1 | |||
XM_017007799.1 | 2418 | Missense Mutation | TTG,TTT | L,F 656 | XP_016863288.1 |