Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCTTCAGGGCTAAGATTAGGCCG[T/A]TAGCCACTGTCCATGACCCCGTAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 177046 MIM: 170260 MIM: 170261 | ||||||||||||||||||||
Literature Links: |
PSMB8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PSMB8 - proteasome subunit beta 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004159.4 | 1155 | Nonsense Mutation | TAA,TAT | *,Y 211 | NP_004150.1 | |
NM_148919.3 | 1155 | Nonsense Mutation | TAA,TAT | *,Y 215 | NP_683720.2 |
PSMB8-AS1 - PSMB8 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAP1 - transporter 1, ATP binding cassette subfamily B member | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAP2 - transporter 2, ATP binding cassette subfamily B member | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |