Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACCTGATGGGTGTGGCGGGGAGGG[G/T]GGGGGTGCCGGAGGAGGTGACGGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601417 MIM: 611500 MIM: 602045 MIM: 601416 | ||||||||||||||||||||
Literature Links: |
HSD17B8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSD17B8 - hydroxysteroid 17-beta dehydrogenase 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR219A1 - microRNA 219a-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RING1 - ring finger protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002931.3 | 1202 | Silent Mutation | GGG,GGT | G,G 336 | NP_002922.2 |
SLC39A7 - solute carrier family 39 member 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |