Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTAAAATCATCTGGGCCTGAGGCT[C/T]TTTTTCCTTTAAGCGGGGTGAGGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610242 MIM: 610241 | ||||||||||||||||||||
Literature Links: |
C7orf13 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C7orf13 - chromosome 7 open reading frame 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927858 - uncharacterized LOC101927858 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF32 - ring finger protein 32 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184996.1 | Intron | NP_001171925.1 | ||||
NM_001184997.1 | Intron | NP_001171926.1 | ||||
NM_001308273.1 | Intron | NP_001295202.1 | ||||
NM_001308274.1 | Intron | NP_001295203.1 | ||||
NM_030936.3 | Intron | NP_112198.1 | ||||
XM_005249522.4 | Intron | XP_005249579.1 | ||||
XM_011515804.2 | Intron | XP_011514106.1 | ||||
XM_011515805.2 | Intron | XP_011514107.1 | ||||
XM_011515806.2 | Intron | XP_011514108.1 | ||||
XM_011515807.2 | Intron | XP_011514109.1 | ||||
XM_011515808.2 | Intron | XP_011514110.1 | ||||
XM_011515809.2 | Intron | XP_011514111.1 | ||||
XM_011515810.2 | Intron | XP_011514112.1 | ||||
XM_011515811.2 | Intron | XP_011514113.1 | ||||
XM_011515812.2 | Intron | XP_011514114.1 | ||||
XM_011515813.2 | Intron | XP_011514115.1 | ||||
XM_017011753.1 | Intron | XP_016867242.1 | ||||
XM_017011754.1 | Intron | XP_016867243.1 | ||||
XM_017011755.1 | Intron | XP_016867244.1 |