Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACACTGTCCACTTTGGCCGTGGCTG[G/T]GAACCGTACGGTGGCCCATCACTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612510 MIM: 608037 MIM: 615245 MIM: 601737 | ||||||||||||||||||||
Literature Links: |
ABCF2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABCF2 - ATP binding cassette subfamily F member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CHPF2 - chondroitin polymerizing factor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284295.1 | 1882 | Missense Mutation | GGG,GTG | G,V 112 | NP_001271224.1 | |
NM_019015.2 | 1882 | Missense Mutation | GGG,GTG | G,V 120 | NP_061888.1 |
MIR671 - microRNA 671 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMARCD3 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |