Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCCGCTACCTGCCCCACGGGCTG[G/T]GTGAGGGGCAGCCCCTGCGCCTGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610047 MIM: 602955 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CNPY4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CNPY4 - canopy FGF signaling regulator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LAMTOR4 - late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MBLAC1 - metallo-beta-lactamase domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_203397.2 | 890 | Missense Mutation | GGT,TGT | G,C 150 | NP_981942.1 | |
XM_005250250.3 | 890 | Missense Mutation | GGT,TGT | G,C 150 | XP_005250307.1 |
TAF6 - TATA-box binding protein associated factor 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001190415.1 | 890 | Intron | NP_001177344.1 | |||
NM_005641.3 | 890 | Intron | NP_005632.1 | |||
NM_139315.2 | 890 | Intron | NP_647476.1 |