Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGTGAGCATTATTGAGGGAGAGAA[C/G]GGAGGGTGAGAGCACCCGCACGGTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609088 MIM: 605109 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FBXL22 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FBXL22 - F-box and leucine rich repeat protein 22 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_203373.2 | 14837 | Intron | NP_976307.2 | |||
XM_005254320.3 | 14837 | Intron | XP_005254377.1 | |||
XM_006720478.1 | 14837 | Intron | XP_006720541.1 | |||
XM_011521468.2 | 14837 | Intron | XP_011519770.1 | |||
XM_011521469.1 | 14837 | Intron | XP_011519771.1 | |||
XM_011521472.2 | 14837 | Intron | XP_011519774.1 | |||
XM_017022086.1 | 14837 | Intron | XP_016877575.1 |
HERC1 - HECT and RLD domain containing E3 ubiquitin protein ligase family member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003922.3 | 14837 | UTR 3 | NP_003913.3 | |||
XM_017022699.1 | 14837 | UTR 3 | XP_016878188.1 | |||
XM_017022700.1 | 14837 | UTR 3 | XP_016878189.1 | |||
XM_017022701.1 | 14837 | UTR 3 | XP_016878190.1 | |||
XM_017022702.1 | 14837 | UTR 3 | XP_016878191.1 | |||
XM_017022703.1 | 14837 | UTR 3 | XP_016878192.1 | |||
XM_017022704.1 | 14837 | UTR 3 | XP_016878193.1 | |||
XM_017022705.1 | 14837 | UTR 3 | XP_016878194.1 | |||
XM_017022706.1 | 14837 | Intron | XP_016878195.1 |
USP3-AS1 - USP3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |