Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCCAGACAATGTCCAGGATCTTG[A/C]GAAGAATGGACCCTACCAATGGCAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616701 MIM: 154580 MIM: 608844 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
COMMD4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
COMMD4 - COMM domain containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAN2C1 - mannosidase alpha class 2C member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR631 - microRNA 631 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NEIL1 - nei like DNA glycosylase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256552.1 | Intron | NP_001243481.1 | ||||
NM_024608.3 | Intron | NP_078884.2 | ||||
XM_005254659.4 | Intron | XP_005254716.1 | ||||
XM_006720677.3 | Intron | XP_006720740.1 | ||||
XM_006720678.3 | Intron | XP_006720741.1 | ||||
XM_006720679.3 | Intron | XP_006720742.1 | ||||
XM_006720680.1 | Intron | XP_006720743.1 | ||||
XM_006720681.1 | Intron | XP_006720744.1 | ||||
XM_011522001.2 | Intron | XP_011520303.2 | ||||
XM_011522002.1 | Intron | XP_011520304.1 | ||||
XM_011522003.2 | Intron | XP_011520305.1 | ||||
XM_011522004.2 | Intron | XP_011520306.1 | ||||
XM_011522005.1 | Intron | XP_011520307.1 | ||||
XM_011522006.1 | Intron | XP_011520308.1 | ||||
XM_011522007.1 | Intron | XP_011520309.1 | ||||
XM_011522008.1 | Intron | XP_011520310.1 | ||||
XM_017022566.1 | Intron | XP_016878055.1 | ||||
XM_017022567.1 | Intron | XP_016878056.1 | ||||
XM_017022568.1 | Intron | XP_016878057.1 |