Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TATCCCGCGTGTCCTGGGTACAGAA[C/G]GGCTGCAGGCAGCGCAGGCTCTGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600924 MIM: 611256 MIM: 603927 MIM: 605915 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GFER PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GFER - growth factor, augmenter of liver regeneration | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOXO1 - NADPH oxidase organizer 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267721.1 | 886 | Silent Mutation | CCC,CCG | P,P 172 | NP_001254650.1 | |
NM_144603.3 | 886 | Silent Mutation | CCC,CCG | P,P 167 | NP_653204.1 | |
NM_172167.2 | 886 | Silent Mutation | CCC,CCG | P,P 168 | NP_751907.1 | |
NM_172168.2 | 886 | Silent Mutation | CCC,CCG | P,P 173 | NP_751908.1 | |
XM_005255099.4 | 886 | Silent Mutation | CCC,CCG | P,P 173 | XP_005255156.1 | |
XM_017022927.1 | 886 | Silent Mutation | CCC,CCG | P,P 173 | XP_016878416.1 | |
XM_017022928.1 | 886 | Silent Mutation | CCC,CCG | P,P 173 | XP_016878417.1 |
SYNGR3 - synaptogyrin 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBL3 - transducin beta like 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |