Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCGTGGGGGCTGAGCCTCCTCAGG[A/G]ACCCCTTCTGGGGGTCCGGCAGGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605847 MIM: 600435 | ||||||||||||||||||||
Literature Links: |
BCL7C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BCL7C - BCL tumor suppressor 7C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286526.1 | 1001 | Silent Mutation | GTC,GTT | V,V 134 | NP_001273455.1 | |
NM_004765.3 | 1001 | Silent Mutation | GTC,GTT | V,V 134 | NP_004756.2 | |
XM_011545980.2 | 1001 | Silent Mutation | GTC,GTT | V,V 134 | XP_011544282.1 | |
XM_017023885.1 | 1001 | Silent Mutation | GTC,GTT | V,V 134 | XP_016879374.1 | |
XM_017023886.1 | 1001 | Silent Mutation | GTC,GTT | V,V 134 | XP_016879375.1 | |
XM_017023887.1 | 1001 | Silent Mutation | GTC,GTT | V,V 134 | XP_016879376.1 | |
XM_017023888.1 | 1001 | Silent Mutation | GTC,GTT | V,V 134 | XP_016879377.1 |
CTF1 - cardiotrophin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR762 - microRNA 762 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR762HG - MIR762 host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |