Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCACTGGCTGGTGCTCTGTGGTGG[C/G]TATGAGTAGGGGACGGGGCCGCCTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610660 MIM: 614574 MIM: 611562 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GLYR1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GLYR1 - glyoxylate reductase 1 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ROGDI - rogdi homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024589.2 | 1297 | UTR 3 | NP_078865.1 | |||
XM_006720947.3 | 1297 | UTR 3 | XP_006721010.1 | |||
XM_006720948.3 | 1297 | UTR 3 | XP_006721011.1 |
SEPT12 - septin 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMIM22 - small integral membrane protein 22 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001253790.1 | 1297 | Intron | NP_001240719.1 | |||
NM_001253791.1 | 1297 | Intron | NP_001240720.1 | |||
NM_001253793.1 | 1297 | Intron | NP_001240722.1 | |||
NM_001253794.1 | 1297 | Intron | NP_001240723.1 | |||
XM_011522499.2 | 1297 | Intron | XP_011520801.1 | |||
XM_011522500.2 | 1297 | Intron | XP_011520802.1 | |||
XM_011522501.2 | 1297 | Intron | XP_011520803.1 |