Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTACGACTACCTGCTCAAGTTCCTG[C/T]TGGTGGGCGACAGCGACGTGGGCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605754 | ||||||||||||||||||||
Literature Links: |
LOC101929280 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC101929280 - uncharacterized LOC101929280 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGQ - phosphatidylinositol glycan anchor biosynthesis class Q | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB40C - RAB40C, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001172663.1 | 129 | Silent Mutation | CTG,TTG | L,L 19 | NP_001166134.1 | |
NM_001172664.1 | 129 | Silent Mutation | CTG,TTG | L,L 19 | NP_001166135.1 | |
NM_001172665.1 | 129 | Silent Mutation | CTG,TTG | L,L 19 | NP_001166136.1 | |
NM_001172666.1 | 129 | Silent Mutation | CTG,TTG | L,L 19 | NP_001166137.1 | |
NM_021168.4 | 129 | Silent Mutation | CTG,TTG | L,L 19 | NP_066991.3 |