Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGACCGTCTGGAGCCAGGCCTGAGT[C/G]GGGGGTGGGAAGAGAGAGCGGCTCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603870 MIM: 612222 MIM: 610970 | ||||||||||||||||||||
Literature Links: |
CBFA2T3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CBFA2T3 - CBFA2/RUNX1 translocation partner 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GALNS - galactosamine (N-acetyl)-6-sulfatase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PABPN1L - poly(A) binding protein nuclear 1 like (cytoplasmic) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080487.2 | 93 | Silent Mutation | CCC,CCG | P,P 13 | NP_001073956.2 | |
NM_001294328.1 | 93 | Silent Mutation | CCC,CCG | P,P 13 | NP_001281257.1 | |
XM_017023230.1 | 93 | Silent Mutation | CCC,CCG | P,P 13 | XP_016878719.1 |
TRAPPC2L - trafficking protein particle complex 2-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |