Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGAGAAAAATAGATGGAAGAGAGA[C/T]GTTATAGTGGCACCTACTGGCTATC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616967 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ALOX15P1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ALOX15P1 - arachidonate 15-lipoxygenase pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C17orf100 - chromosome 17 open reading frame 100 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KIAA0753 - KIAA0753 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MED31 - mediator complex subunit 31 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016060.2 | Intron | NP_057144.1 | ||||
XM_017024710.1 | Intron | XP_016880199.1 |
MIR4520-1 - microRNA 4520-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4520-2 - microRNA 4520-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TXNDC17 - thioredoxin domain containing 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |