Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACCCAGACAGCCCAGCCACGGGGG[A/G]GCAGTGGATGGCTAAGCCTGTGGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607470 MIM: 600747 | ||||||||||||||||||||
Literature Links: |
BCAS3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BCAS3 - BCAS3, microtubule associated cell migration factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C17orf82 - chromosome 17 open reading frame 82 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBX2 - T-box 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005994.3 | 871 | Missense Mutation | GAG,GGG | E,G 197 | NP_005985.3 | |
XM_011525159.1 | 871 | Intron | XP_011523461.1 |
TBX2-AS1 - TBX2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |