Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAGGGAAATAATCTATTCTGAGGC[A/T]TAAGGGTTTGGCTCCATGGTTTTTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608759 MIM: 610598 MIM: 610137 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CYGB PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CYGB - cytoglobin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRCD - progressive rod-cone degeneration | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNHG16 - small nucleolar RNA host gene 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1A - small nucleolar RNA, C/D box 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1B - small nucleolar RNA, C/D box 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1C - small nucleolar RNA, C/D box 1C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ST6GALNAC2 - ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |