Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGCCGTGTCGGGGGCGGCTCCCCC[A/C]GGTCGCCTTTCCCATCCCGGGAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614271 MIM: 604375 | ||||||||||||||||||||
Literature Links: |
ARL16 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARL16 - ADP ribosylation factor like GTPase 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCDC137 - coiled-coil domain containing 137 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HGS - hepatocyte growth factor-regulated tyrosine kinase substrate | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004712.4 | Intron | NP_004703.1 | ||||
XM_011525463.2 | Intron | XP_011523765.1 | ||||
XM_017025297.1 | Intron | XP_016880786.1 | ||||
XM_017025298.1 | Intron | XP_016880787.1 |