Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGACTTCAGCCTCACGCAGGATC[G/T]GGTATGTAGCTGATGAAAGGCGCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608434 | ||||||||||||||||||||
Literature Links: |
ABHD15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABHD15 - abhydrolase domain containing 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GIT1 - GIT ArfGAP 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TP53I13 - tumor protein p53 inducible protein 13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138349.2 | 349 | Missense Mutation | CGG,CTG | R,L 104 | NP_612358.3 | |
XM_017025282.1 | 349 | Missense Mutation | CGG,CTG | R,L 79 | XP_016880771.1 |