Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCTGGCTGGAGGGAGTGTGGCTG[C/G]TTCCCGCGGGCTTGGAGGCTGGCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614697 MIM: 609522 | ||||||||||||||||||||
Literature Links: |
KATNAL2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KATNAL2 - katanin catalytic subunit A1 like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_031303.2 | 2395 | Intron | NP_112593.2 | |||
XM_005258357.4 | 2395 | Intron | XP_005258414.1 | |||
XM_005258358.4 | 2395 | Intron | XP_005258415.1 | |||
XM_005258361.3 | 2395 | Intron | XP_005258418.1 | |||
XM_006722554.3 | 2395 | Intron | XP_006722617.1 | |||
XM_011526219.2 | 2395 | Intron | XP_011524521.1 | |||
XM_011526220.1 | 2395 | Intron | XP_011524522.1 | |||
XM_011526221.2 | 2395 | Intron | XP_011524523.1 | |||
XM_011526223.2 | 2395 | Intron | XP_011524525.1 | |||
XM_017026028.1 | 2395 | Intron | XP_016881517.1 | |||
XM_017026029.1 | 2395 | Intron | XP_016881518.1 | |||
XM_017026030.1 | 2395 | Intron | XP_016881519.1 | |||
XM_017026031.1 | 2395 | Intron | XP_016881520.1 | |||
XM_017026032.1 | 2395 | Intron | XP_016881521.1 |
TCEB3B - transcription elongation factor B subunit 3B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016427.2 | 2395 | Missense Mutation | ACC,AGC | T,S 681 | NP_057511.2 |
TCEB3C - transcription elongation factor B subunit 3C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCEB3CL - transcription elongation factor B subunit 3C like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |