Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCTAGACCCTATCTCCATGGCTG[G/T]GGCCCTTCAGGACTACATGGCCCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601340 MIM: 612945 | ||||||||||||||||||||
Literature Links: |
MIA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIA - melanoma inhibitory activity | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001202553.1 | 312 | Missense Mutation | GGG,GTG | G,V 49 | NP_001189482.1 | |
NM_006533.3 | 312 | Missense Mutation | GGG,GTG | G,V 49 | NP_006524.1 |
MIA-RAB4B - MIA-RAB4B readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB4B - RAB4B, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB4B-EGLN2 - RAB4B-EGLN2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |