Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTACGACAGCAGCATGAGCGCCCAC[A/G]GGAAGAGGAAGCCCACGAACACCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600551 MIM: 606580 | ||||||||||||||||||||
Literature Links: |
GPR4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GPR4 - G protein-coupled receptor 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005282.2 | 2111 | Missense Mutation | NP_005273.1 | |||
XM_017026607.1 | 2111 | Missense Mutation | XP_016882096.1 | |||
XM_017026608.1 | 2111 | Missense Mutation | XP_016882097.1 |
OPA3 - optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |