Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTGGAGCGTATGACTTTATTGATC[C/T]AGGACATGTATTTGCAGATCTGGGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602673 MIM: 604434 MIM: 605504 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
KLK10 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
KLK10 - kallikrein related peptidase 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001077500.1 | 908 | Nonsense Mutation | TAG,TGG | *,W 268 | NP_001070968.1 | |
NM_002776.4 | 908 | Nonsense Mutation | TAG,TGG | *,W 268 | NP_002767.2 | |
NM_145888.2 | 908 | Nonsense Mutation | TAG,TGG | *,W 268 | NP_665895.1 | |
XM_005259061.3 | 908 | Nonsense Mutation | TAG,TGG | *,W 268 | XP_005259118.1 | |
XM_005259062.3 | 908 | Nonsense Mutation | TAG,TGG | *,W 268 | XP_005259119.1 | |
XM_006723287.3 | 908 | Nonsense Mutation | TAG,TGG | *,W 268 | XP_006723350.1 | |
XM_006723289.3 | 908 | Nonsense Mutation | TAG,TGG | *,W 268 | XP_006723352.1 | |
XM_017026993.1 | 908 | Nonsense Mutation | TAG,TGG | *,W 268 | XP_016882482.1 |
KLK11 - kallikrein related peptidase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLK9 - kallikrein related peptidase 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |