Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGATGGGCTGTGGTGGGTGGGTCC[A/C]GTCTAATTGTTCTTCATCGTCTCCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602673 MIM: 604434 MIM: 605539 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
KLK10 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
KLK10 - kallikrein related peptidase 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLK11 - kallikrein related peptidase 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136032.2 | 885 | UTR 3 | NP_001129504.1 | |||
NM_001167605.1 | 885 | UTR 3 | NP_001161077.1 | |||
NM_006853.2 | 885 | UTR 3 | NP_006844.1 | |||
NM_144947.1 | 885 | UTR 3 | NP_659196.1 | |||
XM_005258439.3 | 885 | UTR 3 | XP_005258496.1 | |||
XM_011526369.1 | 885 | UTR 3 | XP_011524671.1 | |||
XM_011526370.2 | 885 | UTR 3 | XP_011524672.1 | |||
XM_011526371.2 | 885 | UTR 3 | XP_011524673.1 | |||
XM_011526372.2 | 885 | UTR 3 | XP_011524674.1 | |||
XM_011526373.1 | 885 | UTR 3 | XP_011524675.1 |
KLK12 - kallikrein related peptidase 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |