Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGCGCTGTACCTGGAGTCCTCCA[C/T]GTACTCCTCCACAGGACCCCCGGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609809 MIM: 609493 MIM: 614639 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LIME1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LIME1 - Lck interacting transmembrane adaptor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC2A4RG - SLC2A4 regulator | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB46 - zinc finger and BTB domain containing 46 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_025224.3 | 3594 | UTR 3 | NP_079500.2 | |||
XM_005260195.4 | 3594 | UTR 3 | XP_005260252.1 | |||
XM_005260196.3 | 3594 | UTR 3 | XP_005260253.1 | |||
XM_005260197.4 | 3594 | UTR 3 | XP_005260254.1 | |||
XM_005260198.4 | 3594 | UTR 3 | XP_005260255.1 | |||
XM_006723700.3 | 3594 | UTR 3 | XP_006723763.1 | |||
XM_011528548.2 | 3594 | UTR 3 | XP_011526850.1 | |||
XM_011528549.2 | 3594 | Intron | XP_011526851.1 | |||
XM_017027667.1 | 3594 | Intron | XP_016883156.1 |
ZGPAT - zinc finger CCCH-type and G-patch domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |