Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCCCGTCCCCACCCTCGCCACGG[T/C]CCCGCCGCCGCCCGCGCGCACCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607114 MIM: 603130 | ||||||||||||||||||||
Literature Links: |
ADAM33 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADAM33 - ADAM metallopeptidase domain 33 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ATRN - attractin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GFRA4 - GDNF family receptor alpha 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022139.3 | 414 | Intron | NP_071422.1 | |||
NM_145762.2 | 414 | Silent Mutation | GGA,GGG | G,G 138 | NP_665705.1 | |
XM_005260793.2 | 414 | Intron | XP_005260850.1 |