Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGTGACCCTTGCAGCCATCCTATG[C/T]GGTAGGTGCTACCATTGCCATGGAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608077 MIM: 609518 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
P2RX6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
P2RX6 - purinergic receptor P2X 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001159554.1 | Intron | NP_001153026.1 | ||||
NM_005446.3 | Intron | NP_005437.2 | ||||
XM_005261819.3 | Intron | XP_005261876.1 | ||||
XM_011530498.2 | Intron | XP_011528800.1 | ||||
XM_011530499.2 | Intron | XP_011528801.1 | ||||
XM_011530500.2 | Intron | XP_011528802.1 | ||||
XM_011530501.2 | Intron | XP_011528803.1 | ||||
XM_011530502.2 | Intron | XP_011528804.1 | ||||
XM_017029066.1 | Intron | XP_016884555.1 | ||||
XM_017029067.1 | Intron | XP_016884556.1 | ||||
XM_017029068.1 | Intron | XP_016884557.1 | ||||
XM_017029069.1 | Intron | XP_016884558.1 | ||||
XM_017029070.1 | Intron | XP_016884559.1 | ||||
XM_017029071.1 | Intron | XP_016884560.1 | ||||
XM_017029072.1 | Intron | XP_016884561.1 | ||||
XM_017029073.1 | Intron | XP_016884562.1 | ||||
XM_017029074.1 | Intron | XP_016884563.1 | ||||
XM_017029075.1 | Intron | XP_016884564.1 | ||||
XM_017029076.1 | Intron | XP_016884565.1 |
THAP7 - THAP domain containing 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THAP7-AS1 - THAP7 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUBA3FP - tubulin alpha 3f pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |