Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCAGCCAACTGGTCTTCCAGAAC[C/T]TTCTTCAGTGAGGAGGTTATACCCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603086 MIM: 147310 MIM: 601704 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ART3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ART3 - ADP-ribosyltransferase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130016.2 | 14 | Intron | NP_001123488.1 | |||
NM_001130017.2 | 14 | UTR 5 | NP_001123489.1 | |||
NM_001179.5 | 14 | Intron | NP_001170.2 | |||
XM_005262997.1 | 14 | Intron | XP_005263054.1 | |||
XM_005262999.1 | 14 | Intron | XP_005263056.1 | |||
XM_005263003.1 | 14 | Intron | XP_005263060.1 | |||
XM_005263004.1 | 14 | Intron | XP_005263061.1 | |||
XM_006714220.1 | 14 | Intron | XP_006714283.1 | |||
XM_011531971.1 | 14 | Intron | XP_011530273.1 | |||
XM_017008206.1 | 14 | Intron | XP_016863695.1 | |||
XM_017008207.1 | 14 | Intron | XP_016863696.1 | |||
XM_017008208.1 | 14 | Intron | XP_016863697.1 | |||
XM_017008209.1 | 14 | Intron | XP_016863698.1 | |||
XM_017008210.1 | 14 | Intron | XP_016863699.1 |
CXCL10 - C-X-C motif chemokine ligand 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CXCL9 - C-X-C motif chemokine ligand 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928809 - uncharacterized LOC101928809 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |